Jump to content
Sign in to follow this  

About This Club

Tu es tombé sur une page de recettes de mélange en allemand qui a l'air super, mais toi tu as fait espagnol ? Tu habites près de la frontière et tu voudrais adopter dans cette super raterie italienne, mais tu as peur que "ciao, vorrei un ratto" ne fasse pas bonne impression ? Tu es bilingue français-tamoul, ton swahili n'est pas trop rouillé, et tu veux aider des ratouphiles en détresse ? Le club Traduction est fait pour toi !

  1. What's new in this club
  2. Bon et bien je vois qu'il y a déjà du monde pour l'espagnol J'ai voyagé pas mal en Espagne et Amérique du Sud + espagnol LV1 + une première année de fac d'espagnol à distance (que j'ai lâchement abandonnée hum hum). Je suis donc assez à l'aise à l'oral et l'écrit.
  3. @Aggie @Cocow au cas où vous ne passeriez pas dans le coin, ça peut vous intéresser !
  4. C'est hyper intéressant. Je crois que c'est la première fois que je vois parler de Zeb2 dans le contexte downunder. Visiblement, on retrouve la crête neurale dans l'histoire : https://ghr.nlm.nih.gov/gene/ZEB2 Edit. Et visiblement, Zeb2 est associé chez l'homme à une maladie (syndrome de Mowat-Wilson) très souvent associé à la maladie de Hirschprung (= mégacolon). Ce qui établirait un lien crédible entre downunder et risque de MC. https://fr.wikipedia.org/wiki/Syndrome_de_Mowat-Wilson Il va falloir nettoyer un peu la traduc mais c'est vraiment une super base !!! Merci Wuf
  5. je me rends compte que je ne m'atais jamais inscrite! je suis plus a l'aise sur les études comportementales que génétiques mais bon niveau de compréhension et traduction assez fluide si besoin
  6. et je précise qu'on ne l'a pas fait pour les cookies wuf est parfaitement innocent je n'ai vu la proposition qu'après
  7. plop pouic ! il se trouve que wuf s'est remis plus sérieusement au japonais ces dernières années, alors on est pas bilingue mais si ca peut aider a dégrossir le truc ca pourrait faire quelques heureux sait on jamais ce n'est qu'un premier jet fait ce jour et je pense que ca aurait besoin d'une remise en forme de quelqu'un qui connaitmieux la génétique que nous Soyez indulgent si il y a des maladresses car il a vraiment plus une formation scolaire qu'un vocabulaire scientifique précis dans cette langue mais je ne doute pas que ceux qui s'y connaissent un peu en génétique en tireront globalement quelquechose, place a wuf : le 10 juin 2015 Subvention en aide à la recherche scientifique Rapport de recherche Formulaire C-19, F-19, Z-19 (Commun) Numéro d'établissement: 14301 Article de recherche: Challenging sprouting research(Recherche sur la germination difficile) Période de recherche:2013-2014 Numéro de projet:25640046 Nom du projet de recherche (japonais):Création d'un système de modèle expérimental pour la démonstration d'un modèle de diffusion de la réaction à l'aide du pelage de rats mutant. Montant décidé (toute la période de recherche): (coût direct) 3 100 000 yens Takashi Kuramoto, Université de Kyoto, École supérieure de médecine (professeur agrégé), professeur agrégé Résumé des résultats de la recherche (japonais): Le but ultime est de dériver une équation de modèle de réaction-diffusion à partir du comportement des mélanocytes pour les mutations du pelage (abîmée et descendante?). Tout d'abord, des rats transgéniques Dct-LacZ capables de surveiller les mélanocytes au niveau individuel ont été créés. Nous avons également localisé la mutation Du à environ 1 Mb sur le chromosome 3 du rat et répertorié le gène Zeb2 comme gène candidat potentiel. Les résultats de cette étude ont fourni un outil expérimental pour surveiller le développement des mélanocytes dans les embryons Hooded et Downunder. Il est prévu que de nouvelles équations du modèle de réaction-diffusion seront dérivées du système de modèle Hooded / Downunder à l'avenir. Résumé des résultats de la recherche (anglais): Rreaction-diffusion(RD) model is one of the best-known theoretical models used to explain self-regulated pattern formation.In this study, we tried to establish two rat coat pattern mutations(hooded and Downunder)as an in vivo model to evaluate the RD model in mammals. The hooded rats have a pattern in which the entire ventral surface is white. Dorsally pigmentation is limited to the head and shoulders and a mid-dorsal stripe. The downunder pattern manifests when rats are homozygous for the hooded mutation. The downunder rats have pigmentation in ventral part of the trunk in addition to the hooded pattern. We created a F344-Tg(Dct-LacZ) transgenic rat line to monitor the development of the melanocytes. We mapped the Downunder locus finely to about 1Mb genomic region on rat chromosome 3 and found the Zeb2 gene as a good candidate for the Downunder. Using the transgenic rats, we could monitor the development of the melanocytes in the hooded and Downunder embryos in the further study. mots clés:animaux laboratoire science Kit Zeb2 couleur pelage mutant rat mélanocytes édition style C-19, F-19, Z-19(Common) 1.Contexte au début de la recherche Le modèle réaction-diffusion est un puissant modèle théorique du phénomène de formation de motifs [Kondo and Miura, 2010]. De plus, divers modèles sont formés par l'interaction d'activateurs et d'inhibiteurs. Les simulations informatiques ont reproduit des motifs tels que les rayures de poisson, les doigts des membres et les arrangements de plumes et de cheveux [Asai et al, 1999; Miura et al, 2006]. En 2012, le mécanisme moléculaire de la génération de motifs pigmentaires chez les poissons est devenu apparent [Inaba et al, 2012], mais il n'est pas clair si cela serait vrai pour les mammifères avec des motifs pigmentaires abondants. Nous pensions que Hooded et Downunder, les mutations du pelage caractéristiques des rats, pourraient être expliqués par un modèle de réaction-diffusion et pourraient être un système modèle qui pourrait démontrer ce modèle(?). Les rats(homozygotes?) mutants à capuchon(hooded?) (h) (h / h), également appelés rats (de plaque?), ont une distribution caractéristique de pigments en bande sur la tête et le dos. Des études récentes ont montré que la cause en est l'insertion d'un rétrovirus endogène dans l'intron 1 du gène Kit (codant pour un récepteur présent sur la membrane cellulaire) [Kuramoto et al, 2012]. D'autre part, la mutation Downunder (Du) est une mutation du modèle de couleur de la robe que nous avons isolée au cours du processus de transformation d'un rat de compagnie en animal expérimental, et la distribution des pigments sur le dos du rat h / h a également été distribuée sur l'abdomen,(de maniere symetrique?) 2. Le but de l'étude était d'utiliser le système de modèle mutant Hooded Du pour démontrer un modèle de réaction-diffusion dans la distribution des mélanocytes. 1. Clarifier la distribution des mélanocytes dans les embryons de rats à capuchon(hooded) et les embryons de rats Downunder. 2. Identifiez la mutation responsable de la mutation Du. 3. Établir une équation de modèle de réaction-diffusion qui est cohérente avec le comportement des mélanocytes. 3. Méthode de recherche 1, Préparation d'un rat capable de surveiller le développement des mélanocytes Des rats Tg ayant un transgène lié au gène LacZ en aval de la région promotrice(?) ont été préparés, en se concentrant sur le gène spécifique aux mélanocytes Dopachrometautomerase (Dct). Les amorces suivantes ont été synthétisées pour amplifier l'ADN génomique en amont du gène Dct de rat. RDct_-3237-XmaI ATTACCCGGGCCCGGCATAGAGTAGGAGAG rDct_ + 422-Xho IATTACTCGAGCGGCTCGGCTTCCCACCTGT Avec cette amorce, 3659 pb de -3237 à +422 du gène Dct peuvent être amplifiés. L'ADN génomique amplifié a été traité avec XmaI et XhoI et cloné dans pLacZ-Basic (Clontech). 2. Cartographie fine du locus Du Réexécution du locus Du a été effectuée. 4. Réalisation de recherche 1, Création d'un rat capable de surveiller le développement des mélanocytes en utilisant rDct_-3237-XmaI et rDct_ + 422-XhoI comme modèle pour l'ADN génomique du rat F344 / Stm, environ 3,6 kb en amont du gène Dct a été amplifié. . Ce fragment d'ADN a été traité avec XmaI et Xhol, et cloné dans le site de multiclonage pLacZ-Basic.H / hDu / + h / h + / + contenant la séquence amont du gène Dct Figure 1, Phénotype du rat à capuchon (supérieur) et du rat Downunder (inférieur) Le plasmide (pTK418) a été traité avec XmaI et SalI pour obtenir un fragment d'ADN de 8,2 kb pleine longueur contenant le gène Dct (3,6 kb), LacZ (3,0 kb) et polyA (1,6 kb). La microinjection a été réalisée sur des œufs fécondés prélevés sur F344 / NSlc qui avaient une mutation homozygote Hooded, et 11 descendants ont été obtenus. L'ADN a été extrait de l'extrémité arrière(?) de ces descendants et la présence ou l'absence du gène LacZ a été déterminée par PCR. En conséquence, il a été constaté qu'une femelle avait le transgène et a été utilisée comme rat fondateur. Lorsque le rat fondateur a été croisé avec F344 / NSlc et des portées F1 ont été obtenues, il a été constaté que le transgène était transmis. Par conséquent, une lignée ayant ce gène Dct-LacZ est désignée comme F344-Tg (Dct-LacZ), et la lignée est maintenue. 2. Cartographie fine de la mutation Du Afin de clarifier la mutation Du, une cartographie fine du locus Du a été réalisée. À cette fin, une puce à ADN a été préparée pour la région de 24,21 Mb à 28,7 Mb du chromosome 3 de rat, y compris le locus Du, sur la base de la séquence génomique du rat BN, et l'ADN génomique des rats F344 et F344.Cg-Du a été concentré. Et la séquence nucléotidique a été déterminée. En conséquence, une pluralité de polymorphismes entre les rats F344 et les rats F344.Cg-Du a été obtenue. Treize des polymorphismes d'ADN obtenus ont été développés en tant que marqueurs SNP, et le génotypage de F344.Cg-Du a été effectué. En conséquence, la cartographie était possible entre rs197659597 (24 799 231 pb) à D3-Du-SNP12 (25 836 750 pb) et entre 1 038 kb. Il est connu que le gène de la protéine 1 contenant la glycosyltransférase (Gtdc1) et le gène de l'homeobox2 liant zinccfingerEbox (Zeb2) sont présents dans cette région. Cependant, chez le rat F344.Cd-Du, il n'y avait pas de mutation dans les séquences codantes des deux gènes. Récemment, des souris knock-out du gène Zeb2 ont été générées et il a été démontré que Zeb2 est impliqué dans le développement des mélanocytes [Denecker et al., 2014]. À la suite du reséquençage, aucune mutation de suppression claire n'a été trouvée. Par conséquent, il est hautement probable que la mutation Du est une mutation d'insertion présente dans la région régulatrice de Zeb2 ou similaire. 3. Plans futurs À l'avenir, nous clarifierons le comportement des mélanocytes dans les embryons homozygotes pour la mutation à capuchon en examinant de près les embryons de rats Dct-LacZ. De plus, nous clarifions le comportement des mélanocytes dans les embryons de rats F344.Cg-Du pour voir l'effet de la mutation Du. Ensuite, sur la base de ces données, il est vérifié si le système de modèle mutant Hooded Du peut être utilisé pour démontrer un modèle de diffusion de réaction dans la distribution des mélanocytes. Le rat transgénique F344-Tg (Dct-LacZ) obtenu dans cette étude est une ressource utile pour surveiller le développement et la migration des mélanocytes chez le rat. 5. Principales publications, etc. (soulignées pour le chercheur principal, le coordonnateur de la recherche et le chercheur collaboratif) Takashi Kokomoto, Symposium sur l'origine des rats expérimentaux du point de vue du gène de la couleur du pelagz "Biologie des cellules pigmentaires et de la couleur des cheveux", 61e réunion annuelle de la Société japonaise de science animale expérimentale, 15-17 mai 2014, Sapporo Convention Center Takashi Komoto, Satoshi Nakanishi, Birger Voigt, Tadao Serikawa, Identification of rat hooded mutations, The 60th Annual Meeting of the Japanese Society for Experimental Animal Science, 15-17 mai 2013, Tsukuba International Congress Center , 2014, Shangri-La Hotel Singapore, Singapour [livres] (0 au total) [droits de propriété industrielle] ○ Statut de la demande (0 au total) ○ Statut de l'acquisition (0 au total) [Autres] Site Web etc. Organisme de recherche (1) Chercheur Takashi Komoto(Université de Kyoto, École supérieure de médecine, professeur agrégé) Chercheur n °: 20311409 (2) Aucun coordinateur de recherche (3) Chercheur collaboratif Gaku Miura (Université de Kyushu, Recherche médicale) Département / Professeur) Numéro du chercheur: 10324617
  8. Même si beaucoup d'entre vous ont l'air de bien maîtriser la langue, étant Anglaise, je viens apporter ma petite contribution... si vous avez besoin de traduction orale/écrite ou de correction de texte, peu importe la forme ou le fond, n'hésitez pas à me solliciter! je maîtrise bien le langage zootechnique et scientifique vétérinaire dans les deux langues également.
  9. Anglais courant (C2) de mon côté avec plusieurs années de vie en Angleterre. Par contre, je ne suis pas très scientifique
  10. Espagnol ici (et catalan). l’espagnol est ma langue maternelle
  11. Mon anglais n'est pas parfait mais je sais comprendre un texte, et je m'améliore. Puis vous aidez à traduire peut m'être que bénéfique (s'améliorer en aidant c'est quand même trop bien !)
  12. (Je peux faire depuis le hongrois aussi, dans les deux sens, mais vu l'utilité je ne vais peut-être pas créer un nouveau sujet)
  13. Je n'ai pas des masses de temps, et mon allemand est un peu rouillé, mais je peux traduire vers le français au moins approximativement (y compris allemand scientifique)
  14. J'envoie des cookies faits-maison à la personne qui traduira cet article
  15. Je poste ici. Si quelqu'un a les compétences pour traduire la partie en japonais de cet article sur le downunder : https://kaken.nii.ac.jp/en/file/KAKENHI-PROJECT-25640046/25640046seika.pdf
  16. issu de : Rats forsake chocolate to save a drowning companion , par Emily Underwood, 12 mai 2015 http://www.slate.com/articles/video/video/2015/05/animal_empathy_testing_rats_with_water_and_chocolate_video.html Des rats renoncent à du chocolat pour sauver un compagnon de la noyade Nous avons tous entendu parler du mythe des rats qui abandonnent un navire en plein naufrage. Mais lors de cet abandon, les rats sauveraient-ils des compagnons en détresse ? Une nouvelle étude montre qu'en effet, ils les sauveraient de la noyade - même si on leur offrait du chocolat à la place. Et ils les sauveraient de manière encore plus sûre s'ils avaient déjà eux-même vécu un épisode de noyade, ce qui prouve assurément que les rats ressentent de l'empathie. Peggy Mason, neurobiologiste à l'université de Chicago dans l'Illinois, et qui n'a pas participé à l'étude, a déclaré que de précédentes recherches avaient déjà prouvé que les rats viendraient en aide à compagnon dans le besoin. Par exemple, au cours d'une étude datant de 2011, Peggy Mason et ses collègues ont démontré que si un rat était enfermé dans un tube plastique étriqué, son compagnon de cage non enfermé se focaliserait sur le loquet jusqu'à ce qu'il trouve comment ouvrir le piège. Toutefois les septiques ont avancé que les rongeurs ont aidé non pas parce que leur compagnon souffrait mais plutôt parce qu'ils avaient besoin de lui. La nouvelle étude, faite par des chercheurs de l'université de Kwansei Gakuin au Japon, a mis fin à ces élucubrations. Pour tester l'altruisme des rats, l'équipe a divisé en deux une boîte expérimentale à l'aide d'une partie plastique. D'un côté, un rat était obligé de nager dans de l'eau, chose qu'ils détestent. Pas au point de se noyer (il pouvait grimper sur le rebord), il devait y rester 5 minutes. Son seul moyen de se sortir de cette situation délicate était qu' un autre rat (resté de l'autre côté de la plateforme, au sec) vienne ouvrir la petite trappe circulaire séparant les deux côtés et laisse le rat grimper au sec. L'équipe rapporte aujourd'hui en ligne sur Animal Cognition qu'en quelques jours, les rats restés au sec aidaient régulièrement les autres en ouvrant la trappe. Ils ne l'ouvraient pas quand il n'y avait pas d'eau de l'autre côté, confirmant qu'ils répondaient à la détresse des autres plutôt qu'au besoin d'avoir un compagnon, précise Mason. Elle ajoute que les rats qui avaient été mis dans l'eau précédemment apprenaient bien plus vite comment ouvrir la trappe que ceux qui n'avaient jamais été immergés, suggérant que l'empathie influence leur comportement. "Le rat ne fait pas que reconnaitre la détresse, il est d'autant plus disposé à agir qu'il se rappelle avoir connu la situation avant". Puis l'équipe a soumis les rats au dernier test, mettant face à face chocolat et altruisme. Dans cette expérience, les rats restés au sec devaient choisir entre deux portes : l'une permettait à leur compagnon en détresse de se sauver de la noyade et l'autre leur donnait accès à une friandise au chocolat très appétante. Dans 50 à 80% des cas, les rats choisissaient d'aider leur compagnon avant d'aller chercher la friandise ce qui prouve que le désir ardent d'aider leur "ami" est au moins aussi fort que leur attrait pour la nourriture selon les auteurs. Selon Mason, les humains sont différents des rats de beaucoup de façons, mais l'étude renforce le nombre de preuves déjà croissant selon lesquelles le comportement altruiste a une base évolutionniste , indépendant de la culture et de l'éducation. "Les humains n'aident pas uniquement parce que leur mère leur a appris à aider, nous aidons en partie parce que cela fait partie de notre biologie (reste à voir à quel degré) ".
  17. issu de : Peptide Helps Paralyzed Rats Recover Function, Brett Smith, 6 dec 2014 Mobilité retrouvée pour des rats paralysés grâce au peptide Une lésion médullaire peut être catastrophique et changer la vie des rats, avec la plupart du temps peu d’espoir de retrouver toute leur mobilité.Cependant, une nouvelle étude menée par une grande équipe de chercheurs nord-américains laisse entrevoir un espoir grâce au peptide sigma intracellulaire (PSI) , selon un article du journal Nature.Les chercheurs ont découvert que le PSI aidait les rats de laboratoire atteints de lésion médullaire à retrouver la continence urinaire, la mobilité, ou les deux. Ils ont ajouté que les résultats pourrait signifier que ce composé pourrait être utilisé dans le futur pour traiter des lésions similaires chez l’Homme.« C’est une guérison sans précédent », a déclaré récemment un auteur de l’étude Jerry Silver (professeur de neurosciences à la Case Western Reserve University de Cleveland), « chacun des 21 animaux a retrouvé une fonctionnalité ».N’importe quel patient atteint de lésion médullaire aujourd’hui considérerait le retour d’une seule de ces fonctions comme extraordinare, surtout la continence urinaire, a-t-il ajouté. « Par ailleurs, le PSI a également un potentiel thérapeutique pour les maladies où le corps produit une cicatrisation destructrice telles que la crise cardiaque, les blessures nerveuses périphériques et la sclérose en plaques.Quand un animal souffre d’une blessure au système nerveux central (SNC), des molécules appelées glycoprotéines se rassemblent dans le tissu cicatriciel au niveau de la localisation du trauma et dans le réseau périneuronal . Dans les tissus normaux, les glycoprotéines sont des facteurs essentiels dans les connexions intracellulaires et elles jouent un rôle majeur dans le soutien de la structure du système nerveux.Cependant, après une blessure, les glycoprotéines sont extrêmement nombreuses dans le tissu cicatriciel et dans les réseaux denses autour des synapses dans le SNC. Il en résulte une barrière puissante empêchant la régénération d’avoir lieu. Les glycoprotéines dans les endroits blessés créent une masse adhésive, s’emmêlant et empêchant le bout des fibres nerveuses de former des connexions convenables qui transmettent des signaux entiers par des impulsions électriques.Dans cette étude, les chercheurs ont conçu le PSI pour bloquer l’interrupteur des récepteurs à glycoprotéines des neurones. Ils ont également ajouté une navette appelée « activateur de la transcription » pour envoyer le PSI à travers le SNC et à travers la membrane des cellules. Ceci permet au PSI d’être libéré de manière systématique (contrairement à l’injection directe dans la moëlle épinière).Bradley Lang, auteur de l’étude et étudiant diplômé du Silver Lab à Case Western, a déclaré : « Notre stratégie thérapeutique a été conçue pour être facilement transposable, notre but est de finir par utiliser ce traitement comme suite thérapeutique logique aux lésions médullaires ».Les chercheurs ont utilisé 26 rats paralysés qui ont tous reçu des injections quotidiennes pendant 7 semaines. L’équipe a évalué les capacités à remarcher,à recontrôler sa continence et a vu 21 des 26 rats retrouver une ou plusieurs fonctionnalités après le début des injections.Silver a dit : « Nous ne savons pas pourquoi tel animal retrouve telle capacité, c’est l’une des grandes questions restantes … ».Malgré ces questions restantes, les chercheurs ont déclaré qu’ils étaient optimistes concernant l’utilisation un jour du PSI comme traitement humain des lésions du SNC.Silver a déclaré à l’AFP News Agency « nous sommes très enthousiastes à l’idée qu’un jour des millions de personnes pourraient retrouver leur mobilité perdue à cause de lésion médullaires ».
  18. issu de : Junk food-addicted rats chose to starve themselves rather than eat healthy food , David Gutierrez , 5 aout 201 plus de détails ici : http://www.palmbeachpost.com/news/lifestyles/health/scripps-florida-addicted-rats-starved-themselves-r/nL5pW/ et ici : https://www.sciencenews.org/article/junk-food-turns-rats-addicts Des rats accrocs à la junk-food préfèrent se laisser mourir de faim plutôt que de manger sain. Des chercheurs ont découvert que donner aux rats un régime alimentaire composé d'un nombre illimité d'aliments type "junk-food" peut les rendre tellement accrocs à ce régime malsain qu'ils préféreront se laisser mourir de faim plutôt que de revenir à un régime normal. Dans une série d'études menées sur une durée de 3 ans et publiées dans le journal Nature Neuroscience , Paul Johnson et Paul Kenny (des scientifiques de l'université de Scripps en Floride) ont démontré qu'un parallèle pouvait être fait entre la réponse des rats face à un régime "junk-food" et celle des toxicomanes, y compris quand on en vient aux changements de la chimie cérébrale. Kenny a déclaré : "Nous connaissons les traits caractéristiques de l'addiction et ces animaux présentent chacun de ces traits". Dans leur 1ère étude, les chercheurs ont nourri les rats soit uniquement avec un régime sain, soit avec ce même régime accompagné d'un accès illimité à de la "junk-food" de supermarché (y compris des gateaux et viandes transformés). En très peu de temps, les rats du second groupe ont commencé à présenter des troubles compulsifs alimentaires et sont devenus rapidement obèses. Kenny précise : "ils ingèrent deux fois plus de calories que les rats du premier groupe". Les chercheurs ont alors émis une hypothèse : les rats mangent de manière compulsive car, tout comme les toxicomanes, ils sont devenus insensibles aux petites quantités et ont besoin d'en ingérer toujours plus pour atteindre le même degré de plaisir. Beaucoup de drogues douces fonctionnent en stimulant directement le centre du plaisir au sein du cerveau et principalement les récepteurs D2 de la dopamine. Une trop grande stimulation de ceux-ci entraîne une production de dopamine moindre, menant le drogué à compenser en consommant plus. Etant donné que la dopamine peut être libérée en exerçant des activités telles que le sexe ou la nourriture, Kenny et Johnson ont supposé que l'addiction à la nourriture pouvait donc fonctionner de la même manière. Pour déterminer si les rats s' étaient effectivement habitués à la dopamine, les chercheurs ont connecté directement le cerveau des rats du premier groupe à un appareil qui stimule leurs récepteurs D2 quand ils font de la roue. Les rats mangeant de la "junk-food" font beaucoup plus de roue que les autres, démontrant que leurs récepteurs se sont insensibilisés. Cette profonde insensibilisation a eu lieu après seulement 5 jours de régime. "Ils ne vivent pas les récompenses comme ils le devraient. Quand ils ressentent ça, une manière de se sentir mieux est de retourner manger de la "junk-food" " a déclaré Johnson. "Ils perdent le contrôle, c'est la caractéristique principale de l'addiction". Dans un autre test de leur hypothèse concernant l'addiction, les chercheurs ont inoculé un virus bloquant les récepteurs D2 des rats mangeant sainement. Tous se sont mis à manger de manière compulsive très rapidement. Jonhson déclare : "c'est la preuve ultime démontrant que l'obésité et la toxicomanie ont les mêmes fondements neurobiologiques". Après avoir établi que les rats du second groupe étaient devenus accrocs, Johnson et Kenny ont voulu savoir jusqu'où leur addiction pouvait les mener. Ils ont alors exposé des rats de chaque groupe à des signaux électriques quand ils mangeaient de la "junk-food". Les premiers, habitués à manger sainement ont rapidement arrêté la "junk-food" alors que les seconds sont restés insensibles aux coups de jus et ont continué à manger. La trouvaille certainement la plus choquante est venue quand les chercheurs ont enlevé l'accès à la "junk-food" aux rats du second groupe et les ont à nouveau nourris avec la même nourriture saine qu'ils avaient connue étant ratons. Ces rats ont simplement refusé de manger pendant 2 semaines quand ils n'ont plus eu accès à la nourriture malsaine. Selon Kenny : "Ils se sont en réalité affamés de manière volontaire". "C'est presque comme si vous cassiez quelque chose, c'est très difficile de revenir à ce que les choses étaient avant. Leurs préférences alimentaires ont dramatiquement changées". Cette recherche suggère fortement que de nos jours, beaucoup d'humains souffrent également d'addiction à la nourriture. Cependant, Kenny fait remarquer que contrairement aux rats, tous les humains ayant accès à de la "junk-food" ne deviennent pas forcément obèses. Il attribue cette différence à l'influence des connaissances alimentaires et de la pression sociale sur la capacité à modérer leurs habitudes alimentaires. "Les rats ne souffrent pas de la même pression sociale que nous" a-t-il déclaré. La notion d'addiction alimentaire n'est pas nouvelle, et la relation "junk-food"/dopamine avait été mise en avant par David Kessler (ancien membre de la Food and Drug Administration) dans son best-seller "The end of overeating". Sandy Linvingston, nutritionniste, déclare : "bien sûr nous voyons ce type d'addiction chez les humains, ils savent qu'ils ne doivent pas trop manger, mais ils le font quand même". Elle a exprimé son espoir qu'une meilleure connaissance du côté biochimique de l'addiction alimentaire puisse mener à une moindre culpabilité et à un jugement moins sévère de l'obésité. "Beaucoup de gens s'en veulent et se demandent pourquoi ils n'ont pas la volonté". Jordan Rubin (auteur et fabricant d'un complément alimentaire) déclare : "La nourriture peut être hautement addictive, voilà pourquoi les gens décrivent la suralimentation et la perte de poids comme une guerre". Il appelle à faire plus de recherches sur les composants exacts de la "junk-food" jouant un rôle dans l'addiction. Ralph Dileone (chercheur sur l'obésité à l'université de Yale) a fait remarquer qu'il manquait des recherches sur les effets à long terme de cette addiction, même si un animal finit par changer son régime et perdre du poids plus tard. "Ils peuvent avoir récupéré un poids normal, mais leur réponse à la nourriture peut être définitivement altérée". Suggérant déjà de nouvelles pistes pour des recherches futures, Kenny espère qu'une meilleure compréhension de l'aspect biochimique de l'addiction alimentaire pourra un jour permettre le développement d'un traitement ou d'un vaccin contre les troubles compulsifs alimentaires.
  19. Traduction d'après un article de : http://www.ratbehavior.org Comment les rats choisissent-ils ce qu'ils mangent ? Etre omnivore implique que les rats peuvent exploiter toutes sortes de ressources alimentaires, et donc qu’ils peuvent vivre dans des environnements très différents. C’est d’ailleurs l’une des raisons pour laquelle ils sont une espèce pérenne. Cependant, être omnivore signifie aussi que chaque rat en tant qu’individu est libre de ses choix alimentaires et cela peut s’avérer risqué : le mauvais choix peut lui coûter la vie. On trouve des rats partout dans le monde depuis assez peu longtemps. Malgré son nom, le rattus norvegicus est originaire du nord de la Chine. Il a voyagé avec les humains et a suivi les routes de la colonisation ces derniers siècles. Son expansion est donc extraordinaire du point de vue de l’évolution – il n’a pas eu le temps de s’adapter à ses divers nouveaux environnements. Génétiquement parlant, un raton né dans un port de Nouvelle Ecosse sera assez similaire à un raton né derrière un restaurant à Berlin, dans un égout à Melbourne ou encore dans un marché à Bangkok. Mais la nourriture que chacun de ces rats aura à disposition sera très différente d’un endroit à l’autre. Choisir quoi manger … et quoi délaisser ! L’environnement de chaque rat est rempli d’élements comestibles, ou non comestibles : poisons (naturels ou créés), pierres, plastiques, etc … Alors comment le rat apprend ce qu’il peut manger ou non ? Cet apprentissage se passe en plusieurs étapes mais suit globalement ce principe: « si un autre le mange alors je peux le manger aussi ». Avant la naissance : in utero, les fœtus peuvent détecter des particules odorantes venant de l’alimentation de la mère et passant la barrière placentaire. Peu après la naissance, les nouveau-nés répondent positivement à ces aliments (Hepper, 1988). Ainsi, cet apprentissage vient de la mère et commence avant même que les rats ne viennent au monde. Pendant l’allaitement : les ratons reçoivent des informations sur le régime alimentaire de la mère via son lait. Ils ont par la suite une préférence pour la nourriture qu’elle a consommé pendant la lactation (Bronstein et al, 1975, Galef et Sherry 1973, Galef et Henderson 1972). Le sevrage : Quand les ratons sont en sevrage et commencent à manger solide, ils prennent exemple sur les adultes. Ils farfouillent là où les adultes farfouillent (Galef 1971,1981 ; Galef et Clark 1971 a, b) ou encore là où les adultes ont précédemment laissé leur odeur (Galef et Beck 1985, Galef et Heiber 1976, Laland et Plotkin 1991,1993). Adolescence et âge adulte : quand les rats farfouillent seuls, leurs choix alimentaires sont influencés par des interactions sociales qui peuvent avoir eu lieu très loin. Ils sentent la nourriture sur le poil des autres, sur leurs vibrisses et surtout leur haleine et préfèrent de loin la nourriture que ces rats ont pu manger précédemment (Galef et Wigmore 1983, Posadas-Andrews et Roper 1983). Le signal chimique impliqué ici pourrait être le disulfide de carbone (CS2) présent dans l’haleine du rat. Lorsque l’on expose des rats à de la nourriture dégageant du CS2 ou non, ils préfèrent largement la première (Galef, Mason, Preti et Bean 1988). Le principe de manger ce que les autres mangent aide le rat à identifier ce qui est comestible et réduit les risques pour lui tout en élargissant l’éventail d’aliments comestibles. Ce procédé ne reste cependant pas sans risque : les codes sociaux ne lui apprennent pas à repérer les poisons ; en effet, un rat préférera la nourriture qu’il a senti dans l’haleine d’un autre même si celui-ci était malade ou mourant (Galef, Whigmore et Kennett 1983, Galef, McQuoid et Whiskin 1990, Grover et al 1988). Les rats apprennent également ce qu’il ne faut pas manger, et c’est là qu’intervient l’évitement des poisonsLa néophobie : Quand il s’agit de nourriture les rats sont assez néophobes, ils évitent globalement ce qui est nouveau.Les aversions alimentaires acquises : Si un rat goûte une nourriture nouvelle, il n’en prendra certainement qu’une bouchée la première fois ; s’il tombe malade alors il n’en mangera plus par la suite (Garcia et Koeling 1966)Le Pica : si le rat mange quelque chose qui le rend malade, il ne peut pas vomir mais il a une autre alternative appelée « pica » c’est-à-dire la consommation d’une substance non comestible telle que l’argile (Michell 1976). Quand il se sent malade, il va manger de l’argile qui va aider à dissoudre les effets de la toxine dans son corps (Philips et al 1995, Philips 1999, Sarr et al 1995). Pour conclure, les rats n’ont pas de connaissances alimentaires innées.Ils ont cependant la possibilité d’apprendre quels éléments sont sains et quels éléments sont toxiques dans leur environnement.
  20. Idem dispo pour l'espagnol, en version comme en thème.
  21. D'origine portugaise avec espagnol LV1 pendant ma scolarité je me débrouille pas trop mal pour lire dans ces deux langues. Le sait on jamais c'est parce ce que je n'ai aucune idée de la position des recherches sur le rat domestique dans ces pays là mais je suis dispo si besoin
  22. Merci de vous inscrire ici si vous pouvez aider à faire une traduction en anglais.
  23.  

×
×
  • Create New...

Important Information

En poursuivant votre navigation sur ce site, vous acceptez l’utilisation de cookies permettant d'améliorer votre expérience de navigation et mémoriser vos paramètres utilisateur pendant votre visite. Aucune information contenue dans ces cookies ne permet de vous identifier sans votre permission. SRFA ne transmet aucune information non anonyme à des applications tierces.