Jump to content

Muf&Wuf

SRFAdhérent
  • Content Count

    910
  • Joined

  • Last visited

About Muf&Wuf

  • Rank
    Rattus Confirmus

Mes informations

  • Pronom
    me demander
  • Localisation
    Normandie
  • Nombre de rats
    5
  • Ratlover since
    2005/2006

Recent Profile Visitors

1,602 profile views
  1. Quels sont vos principaux critères pour prendre la décision d'euthanasie (refus de nourriture, perte d'autonomie, paralysie, douleurs, dès que l'issue est certaine...) ? Le refus de nourriture souvent ( mais ce n'est pas toujours irreversible, il nous est arrivé pendant des traitements que le ratou ait une perte d'éppétit et après 1 jours ou 2 de petit pot dilué a la pipette, de jus de fruit ect que l'appétit revienne pour le dur ( quand je dis pipette c'est les seringues les plus petites sans aiguille dans la bouche pour aider le ratou ); les états commateux, Si une amélioration de l'état général est impossible et que même avec du nursing la gêne ou la douleur est trop grande pour l'animal Feriez-vous euthanasier un rat grabataire mais qui se nourrit bien avec votre aide, et est plus "vieux" que "malade" ? Jamais, sans nécessité médicale si le nursing et les soins quotidiens permettent un confort suffisant a l'animal et qu'il y a un suivi véto en cas de pathologie je ne me poserais même pas la question et chercherais surtout a ménager l'environnement pour le grabataire Avez-vous déjà pratiqué une euthanasie un peu "en avance" par rapport à la nécessité médicale ? (départ en vacances, impossibilité pratique d'administrer des soins palliatifs appropriés, souhait de faire réaliser le geste par un vétérinaire en particulier, peur de devoir aller aux urgences, besoin d'analyses post-mortem...) et si oui, comment l'avez-vous vécu ? non, je me souviens que pour notre premier rat qui avait des abcès au ventre ( on avait pas internet c'était dégeu et on croyait qu'il allait mourrir, c'était bien avant que l'on connaisse les abcès con du dessous du vente ) le vétérinaire nous l'avait proposé ( a priori par peur qu'on le laisse sans soins et il était vieux ) mais dès qu'on a surcomment s'en occupper le vétérinaire nous a expliqué que faire et il n'en a plus été question, ni a aucune autre consultation, 10 ans après elle nous appelle les rois du nursing mais en yrepensant je pense qu'elle nous aurait proposé une euthanasie de confort si elle avait vu qu'on n'était prêts a faire les soins plutôt que de laisser un animal dans la souffance. Le dernier point de la question pour les analyses post mortems j'avoue que je n'y penserais pas pour prendre la décision alors que c'est important pour moi : si un éleveur en a besoin ou si on a le moindre doute on fait pratiquer des autopsies et analyses, même si je ne suis pas fan a la base l'interêt de la famille passe au dessus de mes sentiments, souvent dans ces cas là je le dit a mon vétérinaire en amont ( pour éviter que j'oublie au moment du départ ou j'ai déjà du mal a gérer mes émotions alors penser a des détails techniques je pourrais oublier comme ca elle sait ce qu'il faut chercher a l'autopsie ) donc penser a l'autopsie en amont de l'euthanasie oui, dans le sens inverse non je serais incapable d'avancer le moment d'une eutha juste pour être sur d'avoir des analyses. D'ailleurs question con, peut on demander une autopsie aux urgences vétérinaires quitte a payer plus cher ? je n'ai encore jamais eu le cas Ressentez-vous une différence dans votre processus de deuil entre les morts naturelles et les euthanasies ? par moments oui, chaque mort est difficile a vivre peut importe comment on s'y prépare et peut importe combien de départ on a déjà vécu, mais souvent quand ils partent a la maison de facon "paisible" c'est a dire qu'on les retrouve sereins en position de sommeil je ne peux pas m'empêcher d'être apaisée, quand c'est réellement une mort naturelle et qu'ils ont vécu une fin de vie de ratou bien remplie on arrive plus facilement/rapidement a ne garder en mémoire que les bons moments et les bons souvenirs, contrairement a une eurha ou même quand tu sais que tu as fais ce qu'il fallait tu ne peux souvent pas t'empêcher de te poser dixmillequestions Avez-vous le sentiment, comme on le dit parfois, de "sentir quand c'est le bon moment" ? hésitez-vous jusqu'au dernier instant ? vous arrive-t-il d'avoir des regrets ? Face a une euthanasie, même quand avec wuf on est persuadé que continuer serait de l'acharnement ou de l'égoisme, même quand c'est manifeste, même quand c'est une évidence..bah j'ai toujours une voix dans ma tête remplie de Et si ? et si javais fait tel truc si on avait fait autrement, si j'étais dans un monde parallèle ect ect, je suis souvent dans le déni en mode c'est pas possible et je m'auto-culpabilise de fou alors que je sais qu'on a fait ce qu'il fallait qu'on agit avec compassion j'ai beau me dire qu'accompagner un être qui nous est cher jusqu'au bout en abrégant ses souffrances si nécessaire c'est aussi une forme d'amour, mais rien n'y fait j'ai toujours ces questions qui me trottent dans la tête a chaque fois, je ne suis pourtant pas maso mais on gère tous nos deuils différemment et moi ca passe par ce moment là de remise en question et d'hypothèses farfelues Ce n'est pas vraiment de l'hésitation mais quand le moment est venu on passe souvent un trés long moment a en discutter avec le vétérinaire, le fait de dire les choses et d'envisager toutes les autres options avant pour m'entendre dire en quoi elle ne sont pas ou plus possibles ca m''aide et on a vraiment une véto cool la dessus on peut en discutter pendant 30 minutes ou plus, elle me laisse toujours les garder contre moi jusqu'a la fin et est trés respectueuse Et pour finir sur une note plus "joyeuse" si on peut dire ne pas oublier l'origine du terme qui signifie une belle mort sisi jvous jure l'étymologie c'est un truc trop fun et cool mais comme mon grec ancien est un peu rouillé je vais citer wikipédia À l'origine, euthanasie (du grec ancien : εὐθανασία / euthanasía : εὖ / eû, « bonne », θάνατος / thánatos, « mort ») désigne le fait d'avoir une mort douce, que cette mort soit naturelle ou provoquée Je ne sais pas si mon intervention aura servic a grand chose a part raconter ma vie mais c'est fait
  2. plop de suivi, le LORD est renseigné et Cerise informée mais je profite de ma présence pour mettre le suivi a jour ici aussi, Aegwyn nous a quitté lors du premier confinement, je vous c/c mes commentaires au LORD pour resituer le contexte quote : Aegwyn avait été opérée d'une première tumeur mammaire il y a 6mois, et avait trés mal supporté l'anesthésie, le post op avait été trés compliqué pour elle. Il y a eu récidive et le vétérinaire n'a pas voulu retenter l'opération au vu des difficultés premières, elle avait donc plusisueres tumeur mais était encore trés active, mangeait et buvait correctemment, se déplacait partout est restait trés vive, puis elle a eu une baisse subite d'état général, n'avait plus de réaction, ne se tenait plus sur ses pattes, elle avait encore le réflexe de déglutir pour prendre l'eau et le petot pot dilué a la seringue mais ne se déplacait plus et restait inerte ( a part quelques reflexes lorsqu'on lui faisait la toilette Nous avons du la faire partir chez le vétérinaire, au vu de son âge nous n'avons pas souhaité faire pratiquer d'autopsie La bonne nouvelle de ce plop de suivi est que shandris fête dans quelque jours ses trois ans Ma grand mère d'amour se déplace toujours dans toute la cage, elle a également deux tumeurs mammaires qui jusqu'ici n'évoluent pas vraiment et qui au vu de son âge n'ont pas été opérées, elle est toujours vive, fait toujours des bisous, et elle est toujours impertubable a ce qui l'entoure tant qu'il y a de la bouffe Elle est toujours autant investie a faire la toilette des jeunes et ils l'aident en retour, la troupe est petite actuellement mais bien soudée Si j'en crois le LORD il y aurait toujours 5 loulous toujours présent dans la fratrie, avez vous des nouvelles a partager ?
  3. Bonjour a titre informatif les rats d'Achérons avait fait une vidéo youtube sur ce sujet on ne la conseillera jamais assez mais tu as aussi des articles de LVM sur le sujet https://sites.google.com/site/lesvoleursdemiettes/Home/identite-et-origines-du-rat/comportement-du-rat-domestique ( je conseille la lecture d'absolument tout le site en fait Après je pense effectivement que si on tentais la mise en forme d'un article exhaustif sur le sujet ca pourrait en interesser beaucoup mais ca ferait un sacré pavé
  4. je me rends compte que je ne m'atais jamais inscrite! je suis plus a l'aise sur les études comportementales que génétiques mais bon niveau de compréhension et traduction assez fluide si besoin
  5. et je précise qu'on ne l'a pas fait pour les cookies wuf est parfaitement innocent je n'ai vu la proposition qu'après
  6. plop pouic ! il se trouve que wuf s'est remis plus sérieusement au japonais ces dernières années, alors on est pas bilingue mais si ca peut aider a dégrossir le truc ca pourrait faire quelques heureux sait on jamais ce n'est qu'un premier jet fait ce jour et je pense que ca aurait besoin d'une remise en forme de quelqu'un qui connaitmieux la génétique que nous Soyez indulgent si il y a des maladresses car il a vraiment plus une formation scolaire qu'un vocabulaire scientifique précis dans cette langue mais je ne doute pas que ceux qui s'y connaissent un peu en génétique en tireront globalement quelquechose, place a wuf : le 10 juin 2015 Subvention en aide à la recherche scientifique Rapport de recherche Formulaire C-19, F-19, Z-19 (Commun) Numéro d'établissement: 14301 Article de recherche: Challenging sprouting research(Recherche sur la germination difficile) Période de recherche:2013-2014 Numéro de projet:25640046 Nom du projet de recherche (japonais):Création d'un système de modèle expérimental pour la démonstration d'un modèle de diffusion de la réaction à l'aide du pelage de rats mutant. Montant décidé (toute la période de recherche): (coût direct) 3 100 000 yens Takashi Kuramoto, Université de Kyoto, École supérieure de médecine (professeur agrégé), professeur agrégé Résumé des résultats de la recherche (japonais): Le but ultime est de dériver une équation de modèle de réaction-diffusion à partir du comportement des mélanocytes pour les mutations du pelage (abîmée et descendante?). Tout d'abord, des rats transgéniques Dct-LacZ capables de surveiller les mélanocytes au niveau individuel ont été créés. Nous avons également localisé la mutation Du à environ 1 Mb sur le chromosome 3 du rat et répertorié le gène Zeb2 comme gène candidat potentiel. Les résultats de cette étude ont fourni un outil expérimental pour surveiller le développement des mélanocytes dans les embryons Hooded et Downunder. Il est prévu que de nouvelles équations du modèle de réaction-diffusion seront dérivées du système de modèle Hooded / Downunder à l'avenir. Résumé des résultats de la recherche (anglais): Rreaction-diffusion(RD) model is one of the best-known theoretical models used to explain self-regulated pattern formation.In this study, we tried to establish two rat coat pattern mutations(hooded and Downunder)as an in vivo model to evaluate the RD model in mammals. The hooded rats have a pattern in which the entire ventral surface is white. Dorsally pigmentation is limited to the head and shoulders and a mid-dorsal stripe. The downunder pattern manifests when rats are homozygous for the hooded mutation. The downunder rats have pigmentation in ventral part of the trunk in addition to the hooded pattern. We created a F344-Tg(Dct-LacZ) transgenic rat line to monitor the development of the melanocytes. We mapped the Downunder locus finely to about 1Mb genomic region on rat chromosome 3 and found the Zeb2 gene as a good candidate for the Downunder. Using the transgenic rats, we could monitor the development of the melanocytes in the hooded and Downunder embryos in the further study. mots clés:animaux laboratoire science Kit Zeb2 couleur pelage mutant rat mélanocytes édition style C-19, F-19, Z-19(Common) 1.Contexte au début de la recherche Le modèle réaction-diffusion est un puissant modèle théorique du phénomène de formation de motifs [Kondo and Miura, 2010]. De plus, divers modèles sont formés par l'interaction d'activateurs et d'inhibiteurs. Les simulations informatiques ont reproduit des motifs tels que les rayures de poisson, les doigts des membres et les arrangements de plumes et de cheveux [Asai et al, 1999; Miura et al, 2006]. En 2012, le mécanisme moléculaire de la génération de motifs pigmentaires chez les poissons est devenu apparent [Inaba et al, 2012], mais il n'est pas clair si cela serait vrai pour les mammifères avec des motifs pigmentaires abondants. Nous pensions que Hooded et Downunder, les mutations du pelage caractéristiques des rats, pourraient être expliqués par un modèle de réaction-diffusion et pourraient être un système modèle qui pourrait démontrer ce modèle(?). Les rats(homozygotes?) mutants à capuchon(hooded?) (h) (h / h), également appelés rats (de plaque?), ont une distribution caractéristique de pigments en bande sur la tête et le dos. Des études récentes ont montré que la cause en est l'insertion d'un rétrovirus endogène dans l'intron 1 du gène Kit (codant pour un récepteur présent sur la membrane cellulaire) [Kuramoto et al, 2012]. D'autre part, la mutation Downunder (Du) est une mutation du modèle de couleur de la robe que nous avons isolée au cours du processus de transformation d'un rat de compagnie en animal expérimental, et la distribution des pigments sur le dos du rat h / h a également été distribuée sur l'abdomen,(de maniere symetrique?) 2. Le but de l'étude était d'utiliser le système de modèle mutant Hooded Du pour démontrer un modèle de réaction-diffusion dans la distribution des mélanocytes. 1. Clarifier la distribution des mélanocytes dans les embryons de rats à capuchon(hooded) et les embryons de rats Downunder. 2. Identifiez la mutation responsable de la mutation Du. 3. Établir une équation de modèle de réaction-diffusion qui est cohérente avec le comportement des mélanocytes. 3. Méthode de recherche 1, Préparation d'un rat capable de surveiller le développement des mélanocytes Des rats Tg ayant un transgène lié au gène LacZ en aval de la région promotrice(?) ont été préparés, en se concentrant sur le gène spécifique aux mélanocytes Dopachrometautomerase (Dct). Les amorces suivantes ont été synthétisées pour amplifier l'ADN génomique en amont du gène Dct de rat. RDct_-3237-XmaI ATTACCCGGGCCCGGCATAGAGTAGGAGAG rDct_ + 422-Xho IATTACTCGAGCGGCTCGGCTTCCCACCTGT Avec cette amorce, 3659 pb de -3237 à +422 du gène Dct peuvent être amplifiés. L'ADN génomique amplifié a été traité avec XmaI et XhoI et cloné dans pLacZ-Basic (Clontech). 2. Cartographie fine du locus Du Réexécution du locus Du a été effectuée. 4. Réalisation de recherche 1, Création d'un rat capable de surveiller le développement des mélanocytes en utilisant rDct_-3237-XmaI et rDct_ + 422-XhoI comme modèle pour l'ADN génomique du rat F344 / Stm, environ 3,6 kb en amont du gène Dct a été amplifié. . Ce fragment d'ADN a été traité avec XmaI et Xhol, et cloné dans le site de multiclonage pLacZ-Basic.H / hDu / + h / h + / + contenant la séquence amont du gène Dct Figure 1, Phénotype du rat à capuchon (supérieur) et du rat Downunder (inférieur) Le plasmide (pTK418) a été traité avec XmaI et SalI pour obtenir un fragment d'ADN de 8,2 kb pleine longueur contenant le gène Dct (3,6 kb), LacZ (3,0 kb) et polyA (1,6 kb). La microinjection a été réalisée sur des œufs fécondés prélevés sur F344 / NSlc qui avaient une mutation homozygote Hooded, et 11 descendants ont été obtenus. L'ADN a été extrait de l'extrémité arrière(?) de ces descendants et la présence ou l'absence du gène LacZ a été déterminée par PCR. En conséquence, il a été constaté qu'une femelle avait le transgène et a été utilisée comme rat fondateur. Lorsque le rat fondateur a été croisé avec F344 / NSlc et des portées F1 ont été obtenues, il a été constaté que le transgène était transmis. Par conséquent, une lignée ayant ce gène Dct-LacZ est désignée comme F344-Tg (Dct-LacZ), et la lignée est maintenue. 2. Cartographie fine de la mutation Du Afin de clarifier la mutation Du, une cartographie fine du locus Du a été réalisée. À cette fin, une puce à ADN a été préparée pour la région de 24,21 Mb à 28,7 Mb du chromosome 3 de rat, y compris le locus Du, sur la base de la séquence génomique du rat BN, et l'ADN génomique des rats F344 et F344.Cg-Du a été concentré. Et la séquence nucléotidique a été déterminée. En conséquence, une pluralité de polymorphismes entre les rats F344 et les rats F344.Cg-Du a été obtenue. Treize des polymorphismes d'ADN obtenus ont été développés en tant que marqueurs SNP, et le génotypage de F344.Cg-Du a été effectué. En conséquence, la cartographie était possible entre rs197659597 (24 799 231 pb) à D3-Du-SNP12 (25 836 750 pb) et entre 1 038 kb. Il est connu que le gène de la protéine 1 contenant la glycosyltransférase (Gtdc1) et le gène de l'homeobox2 liant zinccfingerEbox (Zeb2) sont présents dans cette région. Cependant, chez le rat F344.Cd-Du, il n'y avait pas de mutation dans les séquences codantes des deux gènes. Récemment, des souris knock-out du gène Zeb2 ont été générées et il a été démontré que Zeb2 est impliqué dans le développement des mélanocytes [Denecker et al., 2014]. À la suite du reséquençage, aucune mutation de suppression claire n'a été trouvée. Par conséquent, il est hautement probable que la mutation Du est une mutation d'insertion présente dans la région régulatrice de Zeb2 ou similaire. 3. Plans futurs À l'avenir, nous clarifierons le comportement des mélanocytes dans les embryons homozygotes pour la mutation à capuchon en examinant de près les embryons de rats Dct-LacZ. De plus, nous clarifions le comportement des mélanocytes dans les embryons de rats F344.Cg-Du pour voir l'effet de la mutation Du. Ensuite, sur la base de ces données, il est vérifié si le système de modèle mutant Hooded Du peut être utilisé pour démontrer un modèle de diffusion de réaction dans la distribution des mélanocytes. Le rat transgénique F344-Tg (Dct-LacZ) obtenu dans cette étude est une ressource utile pour surveiller le développement et la migration des mélanocytes chez le rat. 5. Principales publications, etc. (soulignées pour le chercheur principal, le coordonnateur de la recherche et le chercheur collaboratif) Takashi Kokomoto, Symposium sur l'origine des rats expérimentaux du point de vue du gène de la couleur du pelagz "Biologie des cellules pigmentaires et de la couleur des cheveux", 61e réunion annuelle de la Société japonaise de science animale expérimentale, 15-17 mai 2014, Sapporo Convention Center Takashi Komoto, Satoshi Nakanishi, Birger Voigt, Tadao Serikawa, Identification of rat hooded mutations, The 60th Annual Meeting of the Japanese Society for Experimental Animal Science, 15-17 mai 2013, Tsukuba International Congress Center , 2014, Shangri-La Hotel Singapore, Singapour [livres] (0 au total) [droits de propriété industrielle] ○ Statut de la demande (0 au total) ○ Statut de l'acquisition (0 au total) [Autres] Site Web etc. Organisme de recherche (1) Chercheur Takashi Komoto(Université de Kyoto, École supérieure de médecine, professeur agrégé) Chercheur n °: 20311409 (2) Aucun coordinateur de recherche (3) Chercheur collaboratif Gaku Miura (Université de Kyushu, Recherche médicale) Département / Professeur) Numéro du chercheur: 10324617
  7. et pour la photo demandée de Tauriel @Les Ratconteurs par contre je ne sais pourquoi elle s'est uploadée a l'envers Pardon pour la qualité médiocre mais elles sont quasi impossible a prendre en photo pas floue lol, là j'ai juste eue de la chance que les cheveux de wuf l'ont ralentie
  8. pouic addendum : suite au recalibrage de la balance et de sa tare hier je confirme les poids réels des puces ( je me disait aussi que ca me paraissait peu vu leur gabarits ) Tauriel est a 382 gr et Tilda a 387 gr a la pesée d'hier soir
  9. plop de suivi en confinement. Juste pour mentionner que yaewyn a eu plusieurs crises respiratoires au cours de ca vie, il est stabilisé depuis de nombreux mois mais reste trés sensible. Jasquier RAs a part un point noir sur le dos. Les deux ont toujours été très timide mais commence a prendre du poil de la bête depuis que la troupe est réduite et qu'ils ne peuvent pas se cacher derrière les copains de trés gentils moutons
  10. plop de revenant, pouic de confinement. Cerise a bien sur des nouvelles régulières et avait fait remonter l'info pour notre regrettée princesse sela Mary read a la maison se porte comme un charme, depuis l'arrivée des petites nouvelles elle a un regain d'activité et d'énergie (elle commencait a devenir un peu memere avant l'age avant l'arrivée des dernières ) Mary elle est dooooooooooooouuuuuuuuuuuce c'est la rate la plus douce au toucher a l'âge adulte que j'ai jamais eu elle est trés vive et active, même pas de bourelets, un amour de ratoune qui adore faire des bêtises autant que le reste de la troupe, une fofolle comme on les aime ici
  11. pouic de confinement ! Je profite d'avoir fait le google drive du suivi et d'avoir un chouille plus de temps pour venir donner des news ici c'est fou ce que Gustave ressemble a Tauriel Tilda faire 357 gr et tauriel 332gr a la dernière pesée d'hier Les deux chéries sont merveilleusement pleines de vies et font un bien fou a la troupe, elles sont encore trés joueuses et aime toiletter et se faire toiletter, genre tilda quand elle a envie d'une toilette elle vient ramper sous la tête des plus vieilles jusqu'a ce qu'on lui fasse sa toilette ( ou qu'on la domine parcequ'elle est relou lol ) Elles ont un magnifique physique tout en longeur, de vrais beautées
  12. Moussaillon quand a lui reste vaillemment un raton dans sa tête et profite d'une maison de repos royale pour piraton a la retraite, il a développé une tumeur il y a quelques mois, il a été décidé au vu de son âge et d'un probleme de coagulation cet été ( blessure conne et plus de 24h de stress et d'observation chez le véto avant que ca coagule vraiment ) de ne pas tenter une opération comme kundun sa tumeur s'est stabilisée et de grossit plus ces derniers temps, arte a eu le droit aux dernières photos moches en exclu, j'essaierais d'en reprendre a poster ici dans les temps a venir pouic bisous au reste de la fratrie
  13. plop de revenant, pouic de confinement je profite d'être bientôt en chomage partiel pour venir directement donner des nouvelles ici, un gros merci a artefact pour avoir relayé les nouvelles durant une période difficile pour moi tout d'abord la partie triste, concernant le pauvre kingfisher qui nous as quitté trop tôt,le 07juin2019 déjà sans aucun signe avant coureur je vous c/c ce que j'avais mis sur sa fiche LORD : kingfisher avait eu plusieurs soucis respiratoires durant sa vie et en était resté amaigri, il a été retrouvé dans une position de sommeil paisible sans aucun signe de difficulté respiratoire, au vu de son eg et son age le vétérinaire n'a pas jugé une autopsie pertinente
  14. Plop de revenant, pouic de confinement ! Je profite d'être sous peu au chômage partiel pour venir directement donner des nouvelles ici au lieu d'embêter ma artefact préférée pour faire le lien Bocal a anchois a été assez con pendant une période, surtout avec l'ancien dominant et son ancien lieutenant, il était insistant, poil herissé, coursait trop dans la cage, il fallait le recadrer sans cesse, cela s'est calmé ces derniers temps Coco l'asticot c'est encore différent, il était moins foufou que bocal mais il a un caractère plus posé de base par contre d'un seul coup il va tataner le 1er qui passe, rien de bien méchant cela dit a part parfois une ou deux griffures qui n'ont pas lair intentionnelles vu l'emplacement ( en même temps sur ces copains rex autant dépoilés que des doubles rex ca se voit bien lol ) Coco se laisse bien manipulé et est trés curieux mais c'est bocal qui reste le plus patate proche de l'homme et bisouilleur, il est aussi trés têtu pour faire des conneries On croise pour que ca se maintienne sur cette bonne voie, a part ce caractère con du mois dernier ras chez les deux piratons bisous a la fratrie
  15. plop de revenant et pouic de confinement Je profite d'être bientôt au chomage partiel pour venir donner des nouvelles ici directement, un grand merci a artefact pour avoir relayées les nouvelles régulièrement sur srfa entre temps Kundun ( Le mat pour les non intimes ) vit actuellement sa vie de pirate retraité en cage de repos 3 étoiles avec un copain Moussaillon Il y a quelques mois est apparu une tumeur malheureusement trop mal placée pour être opérée sans risques vers l'aisselle gauche; surement grace a son âge la croisance de la tumeur est maintenant stabilisée si on peut dire, il pète toujours le feu et aprécie la vie a deux avec son copain, bisous a nel et la fraterie
×
×
  • Create New...

Important Information

En poursuivant votre navigation sur ce site, vous acceptez l’utilisation de cookies permettant d'améliorer votre expérience de navigation et mémoriser vos paramètres utilisateur pendant votre visite. Aucune information contenue dans ces cookies ne permet de vous identifier sans votre permission. SRFA ne transmet aucune information non anonyme à des applications tierces.