Jump to content


  • Content Count

  • Joined

  • Last visited

About Muf&Wuf

  • Rank
    Rattus Confirmus

Mes informations

  • Pronom
    me demander
  • Localisation
  • Nombre de rats
  • Ratlover since

Recent Profile Visitors

1,024 profile views
  1. Bonjour a titre informatif les rats d'Achérons avait fait une vidéo youtube sur ce sujet on ne la conseillera jamais assez mais tu as aussi des articles de LVM sur le sujet https://sites.google.com/site/lesvoleursdemiettes/Home/identite-et-origines-du-rat/comportement-du-rat-domestique ( je conseille la lecture d'absolument tout le site en fait Après je pense effectivement que si on tentais la mise en forme d'un article exhaustif sur le sujet ca pourrait en interesser beaucoup mais ca ferait un sacré pavé
  2. je me rends compte que je ne m'atais jamais inscrite! je suis plus a l'aise sur les études comportementales que génétiques mais bon niveau de compréhension et traduction assez fluide si besoin
  3. et je précise qu'on ne l'a pas fait pour les cookies wuf est parfaitement innocent je n'ai vu la proposition qu'après
  4. plop pouic ! il se trouve que wuf s'est remis plus sérieusement au japonais ces dernières années, alors on est pas bilingue mais si ca peut aider a dégrossir le truc ca pourrait faire quelques heureux sait on jamais ce n'est qu'un premier jet fait ce jour et je pense que ca aurait besoin d'une remise en forme de quelqu'un qui connaitmieux la génétique que nous Soyez indulgent si il y a des maladresses car il a vraiment plus une formation scolaire qu'un vocabulaire scientifique précis dans cette langue mais je ne doute pas que ceux qui s'y connaissent un peu en génétique en tireront globalement quelquechose, place a wuf : le 10 juin 2015 Subvention en aide à la recherche scientifique Rapport de recherche Formulaire C-19, F-19, Z-19 (Commun) Numéro d'établissement: 14301 Article de recherche: Challenging sprouting research(Recherche sur la germination difficile) Période de recherche:2013-2014 Numéro de projet:25640046 Nom du projet de recherche (japonais):Création d'un système de modèle expérimental pour la démonstration d'un modèle de diffusion de la réaction à l'aide du pelage de rats mutant. Montant décidé (toute la période de recherche): (coût direct) 3 100 000 yens Takashi Kuramoto, Université de Kyoto, École supérieure de médecine (professeur agrégé), professeur agrégé Résumé des résultats de la recherche (japonais): Le but ultime est de dériver une équation de modèle de réaction-diffusion à partir du comportement des mélanocytes pour les mutations du pelage (abîmée et descendante?). Tout d'abord, des rats transgéniques Dct-LacZ capables de surveiller les mélanocytes au niveau individuel ont été créés. Nous avons également localisé la mutation Du à environ 1 Mb sur le chromosome 3 du rat et répertorié le gène Zeb2 comme gène candidat potentiel. Les résultats de cette étude ont fourni un outil expérimental pour surveiller le développement des mélanocytes dans les embryons Hooded et Downunder. Il est prévu que de nouvelles équations du modèle de réaction-diffusion seront dérivées du système de modèle Hooded / Downunder à l'avenir. Résumé des résultats de la recherche (anglais): Rreaction-diffusion(RD) model is one of the best-known theoretical models used to explain self-regulated pattern formation.In this study, we tried to establish two rat coat pattern mutations(hooded and Downunder)as an in vivo model to evaluate the RD model in mammals. The hooded rats have a pattern in which the entire ventral surface is white. Dorsally pigmentation is limited to the head and shoulders and a mid-dorsal stripe. The downunder pattern manifests when rats are homozygous for the hooded mutation. The downunder rats have pigmentation in ventral part of the trunk in addition to the hooded pattern. We created a F344-Tg(Dct-LacZ) transgenic rat line to monitor the development of the melanocytes. We mapped the Downunder locus finely to about 1Mb genomic region on rat chromosome 3 and found the Zeb2 gene as a good candidate for the Downunder. Using the transgenic rats, we could monitor the development of the melanocytes in the hooded and Downunder embryos in the further study. mots clés:animaux laboratoire science Kit Zeb2 couleur pelage mutant rat mélanocytes édition style C-19, F-19, Z-19(Common) 1.Contexte au début de la recherche Le modèle réaction-diffusion est un puissant modèle théorique du phénomène de formation de motifs [Kondo and Miura, 2010]. De plus, divers modèles sont formés par l'interaction d'activateurs et d'inhibiteurs. Les simulations informatiques ont reproduit des motifs tels que les rayures de poisson, les doigts des membres et les arrangements de plumes et de cheveux [Asai et al, 1999; Miura et al, 2006]. En 2012, le mécanisme moléculaire de la génération de motifs pigmentaires chez les poissons est devenu apparent [Inaba et al, 2012], mais il n'est pas clair si cela serait vrai pour les mammifères avec des motifs pigmentaires abondants. Nous pensions que Hooded et Downunder, les mutations du pelage caractéristiques des rats, pourraient être expliqués par un modèle de réaction-diffusion et pourraient être un système modèle qui pourrait démontrer ce modèle(?). Les rats(homozygotes?) mutants à capuchon(hooded?) (h) (h / h), également appelés rats (de plaque?), ont une distribution caractéristique de pigments en bande sur la tête et le dos. Des études récentes ont montré que la cause en est l'insertion d'un rétrovirus endogène dans l'intron 1 du gène Kit (codant pour un récepteur présent sur la membrane cellulaire) [Kuramoto et al, 2012]. D'autre part, la mutation Downunder (Du) est une mutation du modèle de couleur de la robe que nous avons isolée au cours du processus de transformation d'un rat de compagnie en animal expérimental, et la distribution des pigments sur le dos du rat h / h a également été distribuée sur l'abdomen,(de maniere symetrique?) 2. Le but de l'étude était d'utiliser le système de modèle mutant Hooded Du pour démontrer un modèle de réaction-diffusion dans la distribution des mélanocytes. 1. Clarifier la distribution des mélanocytes dans les embryons de rats à capuchon(hooded) et les embryons de rats Downunder. 2. Identifiez la mutation responsable de la mutation Du. 3. Établir une équation de modèle de réaction-diffusion qui est cohérente avec le comportement des mélanocytes. 3. Méthode de recherche 1, Préparation d'un rat capable de surveiller le développement des mélanocytes Des rats Tg ayant un transgène lié au gène LacZ en aval de la région promotrice(?) ont été préparés, en se concentrant sur le gène spécifique aux mélanocytes Dopachrometautomerase (Dct). Les amorces suivantes ont été synthétisées pour amplifier l'ADN génomique en amont du gène Dct de rat. RDct_-3237-XmaI ATTACCCGGGCCCGGCATAGAGTAGGAGAG rDct_ + 422-Xho IATTACTCGAGCGGCTCGGCTTCCCACCTGT Avec cette amorce, 3659 pb de -3237 à +422 du gène Dct peuvent être amplifiés. L'ADN génomique amplifié a été traité avec XmaI et XhoI et cloné dans pLacZ-Basic (Clontech). 2. Cartographie fine du locus Du Réexécution du locus Du a été effectuée. 4. Réalisation de recherche 1, Création d'un rat capable de surveiller le développement des mélanocytes en utilisant rDct_-3237-XmaI et rDct_ + 422-XhoI comme modèle pour l'ADN génomique du rat F344 / Stm, environ 3,6 kb en amont du gène Dct a été amplifié. . Ce fragment d'ADN a été traité avec XmaI et Xhol, et cloné dans le site de multiclonage pLacZ-Basic.H / hDu / + h / h + / + contenant la séquence amont du gène Dct Figure 1, Phénotype du rat à capuchon (supérieur) et du rat Downunder (inférieur) Le plasmide (pTK418) a été traité avec XmaI et SalI pour obtenir un fragment d'ADN de 8,2 kb pleine longueur contenant le gène Dct (3,6 kb), LacZ (3,0 kb) et polyA (1,6 kb). La microinjection a été réalisée sur des œufs fécondés prélevés sur F344 / NSlc qui avaient une mutation homozygote Hooded, et 11 descendants ont été obtenus. L'ADN a été extrait de l'extrémité arrière(?) de ces descendants et la présence ou l'absence du gène LacZ a été déterminée par PCR. En conséquence, il a été constaté qu'une femelle avait le transgène et a été utilisée comme rat fondateur. Lorsque le rat fondateur a été croisé avec F344 / NSlc et des portées F1 ont été obtenues, il a été constaté que le transgène était transmis. Par conséquent, une lignée ayant ce gène Dct-LacZ est désignée comme F344-Tg (Dct-LacZ), et la lignée est maintenue. 2. Cartographie fine de la mutation Du Afin de clarifier la mutation Du, une cartographie fine du locus Du a été réalisée. À cette fin, une puce à ADN a été préparée pour la région de 24,21 Mb à 28,7 Mb du chromosome 3 de rat, y compris le locus Du, sur la base de la séquence génomique du rat BN, et l'ADN génomique des rats F344 et F344.Cg-Du a été concentré. Et la séquence nucléotidique a été déterminée. En conséquence, une pluralité de polymorphismes entre les rats F344 et les rats F344.Cg-Du a été obtenue. Treize des polymorphismes d'ADN obtenus ont été développés en tant que marqueurs SNP, et le génotypage de F344.Cg-Du a été effectué. En conséquence, la cartographie était possible entre rs197659597 (24 799 231 pb) à D3-Du-SNP12 (25 836 750 pb) et entre 1 038 kb. Il est connu que le gène de la protéine 1 contenant la glycosyltransférase (Gtdc1) et le gène de l'homeobox2 liant zinccfingerEbox (Zeb2) sont présents dans cette région. Cependant, chez le rat F344.Cd-Du, il n'y avait pas de mutation dans les séquences codantes des deux gènes. Récemment, des souris knock-out du gène Zeb2 ont été générées et il a été démontré que Zeb2 est impliqué dans le développement des mélanocytes [Denecker et al., 2014]. À la suite du reséquençage, aucune mutation de suppression claire n'a été trouvée. Par conséquent, il est hautement probable que la mutation Du est une mutation d'insertion présente dans la région régulatrice de Zeb2 ou similaire. 3. Plans futurs À l'avenir, nous clarifierons le comportement des mélanocytes dans les embryons homozygotes pour la mutation à capuchon en examinant de près les embryons de rats Dct-LacZ. De plus, nous clarifions le comportement des mélanocytes dans les embryons de rats F344.Cg-Du pour voir l'effet de la mutation Du. Ensuite, sur la base de ces données, il est vérifié si le système de modèle mutant Hooded Du peut être utilisé pour démontrer un modèle de diffusion de réaction dans la distribution des mélanocytes. Le rat transgénique F344-Tg (Dct-LacZ) obtenu dans cette étude est une ressource utile pour surveiller le développement et la migration des mélanocytes chez le rat. 5. Principales publications, etc. (soulignées pour le chercheur principal, le coordonnateur de la recherche et le chercheur collaboratif) Takashi Kokomoto, Symposium sur l'origine des rats expérimentaux du point de vue du gène de la couleur du pelagz "Biologie des cellules pigmentaires et de la couleur des cheveux", 61e réunion annuelle de la Société japonaise de science animale expérimentale, 15-17 mai 2014, Sapporo Convention Center Takashi Komoto, Satoshi Nakanishi, Birger Voigt, Tadao Serikawa, Identification of rat hooded mutations, The 60th Annual Meeting of the Japanese Society for Experimental Animal Science, 15-17 mai 2013, Tsukuba International Congress Center , 2014, Shangri-La Hotel Singapore, Singapour [livres] (0 au total) [droits de propriété industrielle] ○ Statut de la demande (0 au total) ○ Statut de l'acquisition (0 au total) [Autres] Site Web etc. Organisme de recherche (1) Chercheur Takashi Komoto(Université de Kyoto, École supérieure de médecine, professeur agrégé) Chercheur n °: 20311409 (2) Aucun coordinateur de recherche (3) Chercheur collaboratif Gaku Miura (Université de Kyushu, Recherche médicale) Département / Professeur) Numéro du chercheur: 10324617
  5. et pour la photo demandée de Tauriel @Les Ratconteurs par contre je ne sais pourquoi elle s'est uploadée a l'envers Pardon pour la qualité médiocre mais elles sont quasi impossible a prendre en photo pas floue lol, là j'ai juste eue de la chance que les cheveux de wuf l'ont ralentie
  6. pouic addendum : suite au recalibrage de la balance et de sa tare hier je confirme les poids réels des puces ( je me disait aussi que ca me paraissait peu vu leur gabarits ) Tauriel est a 382 gr et Tilda a 387 gr a la pesée d'hier soir
  7. plop de suivi en confinement. Juste pour mentionner que yaewyn a eu plusieurs crises respiratoires au cours de ca vie, il est stabilisé depuis de nombreux mois mais reste trés sensible. Jasquier RAs a part un point noir sur le dos. Les deux ont toujours été très timide mais commence a prendre du poil de la bête depuis que la troupe est réduite et qu'ils ne peuvent pas se cacher derrière les copains de trés gentils moutons
  8. plop de revenant, pouic de confinement. Cerise a bien sur des nouvelles régulières et avait fait remonter l'info pour notre regrettée princesse sela Mary read a la maison se porte comme un charme, depuis l'arrivée des petites nouvelles elle a un regain d'activité et d'énergie (elle commencait a devenir un peu memere avant l'age avant l'arrivée des dernières ) Mary elle est dooooooooooooouuuuuuuuuuuce c'est la rate la plus douce au toucher a l'âge adulte que j'ai jamais eu elle est trés vive et active, même pas de bourelets, un amour de ratoune qui adore faire des bêtises autant que le reste de la troupe, une fofolle comme on les aime ici
  9. pouic de confinement ! Je profite d'avoir fait le google drive du suivi et d'avoir un chouille plus de temps pour venir donner des news ici c'est fou ce que Gustave ressemble a Tauriel Tilda faire 357 gr et tauriel 332gr a la dernière pesée d'hier Les deux chéries sont merveilleusement pleines de vies et font un bien fou a la troupe, elles sont encore trés joueuses et aime toiletter et se faire toiletter, genre tilda quand elle a envie d'une toilette elle vient ramper sous la tête des plus vieilles jusqu'a ce qu'on lui fasse sa toilette ( ou qu'on la domine parcequ'elle est relou lol ) Elles ont un magnifique physique tout en longeur, de vrais beautées
  10. Moussaillon quand a lui reste vaillemment un raton dans sa tête et profite d'une maison de repos royale pour piraton a la retraite, il a développé une tumeur il y a quelques mois, il a été décidé au vu de son âge et d'un probleme de coagulation cet été ( blessure conne et plus de 24h de stress et d'observation chez le véto avant que ca coagule vraiment ) de ne pas tenter une opération comme kundun sa tumeur s'est stabilisée et de grossit plus ces derniers temps, arte a eu le droit aux dernières photos moches en exclu, j'essaierais d'en reprendre a poster ici dans les temps a venir pouic bisous au reste de la fratrie
  11. plop de revenant, pouic de confinement je profite d'être bientôt en chomage partiel pour venir directement donner des nouvelles ici, un gros merci a artefact pour avoir relayé les nouvelles durant une période difficile pour moi tout d'abord la partie triste, concernant le pauvre kingfisher qui nous as quitté trop tôt,le 07juin2019 déjà sans aucun signe avant coureur je vous c/c ce que j'avais mis sur sa fiche LORD : kingfisher avait eu plusieurs soucis respiratoires durant sa vie et en était resté amaigri, il a été retrouvé dans une position de sommeil paisible sans aucun signe de difficulté respiratoire, au vu de son eg et son age le vétérinaire n'a pas jugé une autopsie pertinente
  12. Plop de revenant, pouic de confinement ! Je profite d'être sous peu au chômage partiel pour venir directement donner des nouvelles ici au lieu d'embêter ma artefact préférée pour faire le lien Bocal a anchois a été assez con pendant une période, surtout avec l'ancien dominant et son ancien lieutenant, il était insistant, poil herissé, coursait trop dans la cage, il fallait le recadrer sans cesse, cela s'est calmé ces derniers temps Coco l'asticot c'est encore différent, il était moins foufou que bocal mais il a un caractère plus posé de base par contre d'un seul coup il va tataner le 1er qui passe, rien de bien méchant cela dit a part parfois une ou deux griffures qui n'ont pas lair intentionnelles vu l'emplacement ( en même temps sur ces copains rex autant dépoilés que des doubles rex ca se voit bien lol ) Coco se laisse bien manipulé et est trés curieux mais c'est bocal qui reste le plus patate proche de l'homme et bisouilleur, il est aussi trés têtu pour faire des conneries On croise pour que ca se maintienne sur cette bonne voie, a part ce caractère con du mois dernier ras chez les deux piratons bisous a la fratrie
  13. plop de revenant et pouic de confinement Je profite d'être bientôt au chomage partiel pour venir donner des nouvelles ici directement, un grand merci a artefact pour avoir relayées les nouvelles régulièrement sur srfa entre temps Kundun ( Le mat pour les non intimes ) vit actuellement sa vie de pirate retraité en cage de repos 3 étoiles avec un copain Moussaillon Il y a quelques mois est apparu une tumeur malheureusement trop mal placée pour être opérée sans risques vers l'aisselle gauche; surement grace a son âge la croisance de la tumeur est maintenant stabilisée si on peut dire, il pète toujours le feu et aprécie la vie a deux avec son copain, bisous a nel et la fraterie
  14. Nous revenons ici aux nouvelles pour la petite finette : la boule qui était apparue en aout proche de son aisselle et variait de taille en fonction de ses chaleurs avait bien augmentée ( toujours bénin et non adhérent et toujours variant légèrement de taille en fonction des chaleurs mais pour reprendre les paroles de la véto le noyau d'olive était devenu une amande ) Finette chérie a donc été opérée le 05/12 avec succès de son lipome, et la véto pense que nous avons bien fait d'opérer tout de suite car la masse était plus grande que nous le voyions ( en partie caché sous l'aisselle ) mais elle confirme que c'était bénin. rien n'était attaché aux muscles , la cicatrice est belle est a été bien placée pour qu'il n'y ai pas trop de frottements pour la cicatrisation Pour l'instant la puce ne touche pas a ses fils même si elle s'est fait une toilette complète tout a l'heure ( et on croise pour que ca dure ), elle était plutôt désorientée hier mais a bien retrouvé ses repères, elle dort encore pas mal mais a bien bu et mangé seule ( un peu de nutrigel cette nuit ) et a eu des selles normales la petite chérie continueras d'être veillée avec attention pendant son post op, nous avons hâte qu'elle rejoigne les copines car elle n'aime pas trop être seule.
  15. Starbuck commence a fondre un peu de l'arrière train, sa tumeur mal placée évolue ^peu et elle reste très énergique,, a la dernière pesée 301gr pour la puce qui fêteras bientôt ses 2ans et demie
  • Create New...

Important Information

En poursuivant votre navigation sur ce site, vous acceptez l’utilisation de cookies permettant d'améliorer votre expérience de navigation et mémoriser vos paramètres utilisateur pendant votre visite. Aucune information contenue dans ces cookies ne permet de vous identifier sans votre permission. SRFA ne transmet aucune information non anonyme à des applications tierces.