Jump to content
Sign in to follow this  
isilna

[japonais] article sur le DU à traduire

Recommended Posts

J'envoie des cookies faits-maison à la personne qui traduira cet article <3<3<3 

  • Love 1

Share this post


Link to post
Share on other sites
Guest Tsukina

Ah ouais... 

Share this post


Link to post
Share on other sites

plop pouic ! il se trouve que wuf s'est remis plus sérieusement au japonais ces dernières années, alors on est pas bilingue mais si ca peut aider a dégrossir le truc ca pourrait faire quelques heureux sait on jamais :) ce n'est qu'un premier jet fait ce jour et je pense que ca aurait besoin d'une remise en forme de quelqu'un qui connaitmieux la génétique que nous ^^ 

 

Soyez indulgent si il y a des maladresses car il a vraiment plus une formation scolaire qu'un vocabulaire scientifique précis dans cette langue mais je ne doute pas que ceux qui s'y connaissent un peu en génétique en tireront globalement quelquechose, place a wuf

 

 

le 10 juin 2015

Subvention en aide à la recherche scientifique Rapport de recherche

Formulaire C-19, F-19, Z-19 (Commun)

 

Numéro d'établissement: 14301

 

Article de recherche: Challenging sprouting research(Recherche sur la germination difficile)

 

Période de recherche:2013-2014

 

Numéro de projet:25640046

 

Nom du projet de recherche (japonais):Création d'un système de modèle expérimental pour la démonstration d'un modèle de diffusion de la réaction à l'aide du pelage de rats mutant.

 

Montant décidé (toute la période de recherche): (coût direct) 3 100 000 yens

 

Takashi Kuramoto, Université de Kyoto, École supérieure de médecine (professeur agrégé), professeur agrégé

 

Résumé des résultats de la recherche (japonais): Le but ultime est de dériver une équation de modèle de réaction-diffusion à partir du comportement des mélanocytes pour les mutations du pelage (abîmée et descendante?). Tout d'abord, des rats transgéniques Dct-LacZ capables de surveiller les mélanocytes au niveau individuel ont été créés. Nous avons également localisé la mutation Du à environ 1 Mb sur le chromosome 3 du rat et répertorié le gène Zeb2 comme gène candidat potentiel. Les résultats de cette étude ont fourni un outil expérimental pour surveiller le développement des mélanocytes dans les embryons Hooded et Downunder. Il est prévu que de nouvelles équations du modèle de réaction-diffusion seront dérivées du système de modèle Hooded / Downunder à l'avenir.

 

Résumé des résultats de la recherche (anglais):

 

Rreaction-diffusion(RD) model is one of the best-known theoretical models used to explain self-regulated pattern formation.In this study, we tried to establish two rat coat pattern mutations(hooded and Downunder)as an in vivo model to evaluate the RD model in mammals. The hooded rats have a pattern in which the entire ventral surface is white. Dorsally pigmentation is limited to the head and shoulders and a mid-dorsal stripe. The downunder pattern manifests when rats are homozygous for the hooded mutation. The downunder rats have pigmentation in ventral part of the trunk in addition to the hooded pattern. We created a F344-Tg(Dct-LacZ) transgenic rat line to monitor the development of the melanocytes. We mapped the Downunder locus finely to about 1Mb genomic region on rat chromosome 3 and found the Zeb2 gene as a good candidate for the Downunder. Using the transgenic rats, we could monitor the development of the melanocytes in the hooded and Downunder embryos in the further study.

 

mots clés:animaux laboratoire science Kit Zeb2 couleur pelage mutant rat mélanocytes

 

édition style C-19, F-19, Z-19(Common)

1.Contexte au début de la recherche

Le modèle réaction-diffusion est un puissant modèle théorique du phénomène de formation de motifs [Kondo and Miura, 2010]. De plus, divers modèles sont formés par l'interaction d'activateurs et d'inhibiteurs. Les simulations informatiques ont reproduit des motifs tels que les rayures de poisson, les doigts des membres et les arrangements de plumes et de cheveux [Asai et al, 1999; Miura et al, 2006]. En 2012, le mécanisme moléculaire de la génération de motifs pigmentaires chez les poissons est devenu apparent [Inaba et al, 2012], mais il n'est pas clair si cela serait vrai pour les mammifères avec des motifs pigmentaires abondants. Nous pensions que Hooded et Downunder, les mutations du pelage caractéristiques des rats, pourraient être expliqués par un modèle de réaction-diffusion et pourraient être un système modèle qui pourrait démontrer ce modèle(?). Les rats(homozygotes?) mutants à capuchon(hooded?) (h) (h / h), également appelés rats (de plaque?), ont une distribution caractéristique de pigments en bande sur la tête et le dos. Des études récentes ont montré que la cause en est l'insertion d'un rétrovirus endogène dans l'intron 1 du gène Kit (codant pour un récepteur présent sur la membrane cellulaire) [Kuramoto et al, 2012]. D'autre part, la mutation Downunder (Du) est une mutation du modèle de couleur de la robe que nous avons isolée au cours du processus de transformation d'un rat de compagnie en animal expérimental, et la distribution des pigments sur le dos du rat h / h a également été distribuée sur l'abdomen,(de maniere symetrique?)

 

2. Le but de l'étude était d'utiliser le système de modèle mutant Hooded Du pour démontrer un modèle de réaction-diffusion dans la distribution des mélanocytes.

1. Clarifier la distribution des mélanocytes dans les embryons de rats à capuchon(hooded) et les embryons de rats Downunder.

2. Identifiez la mutation responsable de la mutation Du.

3. Établir une équation de modèle de réaction-diffusion qui est cohérente avec le comportement des mélanocytes.

 

3. Méthode de recherche

1, Préparation d'un rat capable de surveiller le développement des mélanocytes Des rats Tg ayant un transgène lié au gène LacZ en aval de la région promotrice(?) ont été préparés, en se concentrant sur le gène spécifique aux mélanocytes Dopachrometautomerase (Dct). Les amorces suivantes ont été synthétisées pour amplifier l'ADN génomique en amont du gène Dct de rat.

RDct_-3237-XmaI

ATTACCCGGGCCCGGCATAGAGTAGGAGAG

rDct_ + 422-Xho

IATTACTCGAGCGGCTCGGCTTCCCACCTGT

Avec cette amorce, 3659 pb de -3237 à +422 du gène Dct peuvent être amplifiés. L'ADN génomique amplifié a été traité avec XmaI et XhoI et cloné dans pLacZ-Basic (Clontech).

2. Cartographie fine du locus Du Réexécution du locus Du a été effectuée.

 

4. Réalisation de recherche

1, Création d'un rat capable de surveiller le développement des mélanocytes en utilisant rDct_-3237-XmaI et rDct_ + 422-XhoI comme modèle pour l'ADN génomique du rat F344 / Stm, environ 3,6 kb en amont du gène Dct a été amplifié. . Ce fragment d'ADN a été traité avec XmaI et Xhol, et cloné dans le site de multiclonage pLacZ-Basic.H / hDu / + h / h + / + contenant la séquence amont du gène Dct Figure 1, Phénotype du rat à capuchon (supérieur) et du rat Downunder (inférieur)

Le plasmide (pTK418) a été traité avec XmaI et SalI pour obtenir un fragment d'ADN de 8,2 kb pleine longueur contenant le gène Dct (3,6 kb), LacZ (3,0 kb) et polyA (1,6 kb). La microinjection a été réalisée sur des œufs fécondés prélevés sur F344 / NSlc qui avaient une mutation homozygote Hooded, et 11 descendants ont été obtenus. L'ADN a été extrait de l'extrémité arrière(?) de ces descendants et la présence ou l'absence du gène LacZ a été déterminée par PCR. En conséquence, il a été constaté qu'une femelle avait le transgène et a été utilisée comme rat fondateur. Lorsque le rat fondateur a été croisé avec F344 / NSlc et des portées F1 ont été obtenues, il a été constaté que le transgène était transmis. Par conséquent, une lignée ayant ce gène Dct-LacZ est désignée comme F344-Tg (Dct-LacZ), et la lignée est maintenue.

2. Cartographie fine de la mutation Du

Afin de clarifier la mutation Du, une cartographie fine du locus Du a été réalisée. À cette fin, une puce à ADN a été préparée pour la région de 24,21 Mb à 28,7 Mb du chromosome 3 de rat, y compris le locus Du, sur la base de la séquence génomique du rat BN, et l'ADN génomique des rats F344 et F344.Cg-Du a été concentré. Et la séquence nucléotidique a été déterminée. En conséquence, une pluralité de polymorphismes entre les rats F344 et les rats F344.Cg-Du a été obtenue. Treize des polymorphismes d'ADN obtenus ont été développés en tant que marqueurs SNP, et le génotypage de F344.Cg-Du a été effectué. En conséquence, la cartographie était possible entre rs197659597 (24 799 231 pb) à D3-Du-SNP12 (25 836 750 pb) et entre 1 038 kb. Il est connu que le gène de la protéine 1 contenant la glycosyltransférase (Gtdc1) et le gène de l'homeobox2 liant zinccfingerEbox (Zeb2) sont présents dans cette région. Cependant, chez le rat F344.Cd-Du, il n'y avait pas de mutation dans les séquences codantes des deux gènes. Récemment, des souris knock-out du gène Zeb2 ont été générées et il a été démontré que Zeb2 est impliqué dans le développement des mélanocytes [Denecker et al., 2014]. À la suite du reséquençage, aucune mutation de suppression claire n'a été trouvée. Par conséquent, il est hautement probable que la mutation Du est une mutation d'insertion présente dans la région régulatrice de Zeb2 ou similaire.

 

3. Plans futurs

À l'avenir, nous clarifierons le comportement des mélanocytes dans les embryons homozygotes pour la mutation à capuchon en examinant de près les embryons de rats Dct-LacZ. De plus, nous clarifions le comportement des mélanocytes dans les embryons de rats F344.Cg-Du pour voir l'effet de la mutation Du. Ensuite, sur la base de ces données, il est vérifié si le système de modèle mutant Hooded Du peut être utilisé pour démontrer un modèle de diffusion de réaction dans la distribution des mélanocytes. Le rat transgénique F344-Tg (Dct-LacZ) obtenu dans cette étude est une ressource utile pour surveiller le développement et la migration des mélanocytes chez le rat.

 

5. Principales publications, etc. (soulignées pour le chercheur principal, le coordonnateur de la recherche et le chercheur collaboratif)

Takashi Kokomoto, Symposium sur l'origine des rats expérimentaux du point de vue du gène de la couleur du pelagz "Biologie des cellules pigmentaires et de la couleur des cheveux", 61e réunion annuelle de la Société japonaise de science animale expérimentale, 15-17 mai 2014, Sapporo Convention Center

 

Takashi Komoto, Satoshi Nakanishi, Birger Voigt, Tadao Serikawa, Identification of rat hooded mutations, The 60th Annual Meeting of the Japanese Society for Experimental Animal Science, 15-17 mai 2013, Tsukuba International Congress Center , 2014, Shangri-La Hotel Singapore, Singapour

 

[livres] (0 au total)

[droits de propriété industrielle] ○

Statut de la demande (0 au total) ○

Statut de l'acquisition (0 au total)

[Autres] Site Web etc.

Organisme de recherche

(1) Chercheur Takashi Komoto(Université de Kyoto, École supérieure de médecine, professeur agrégé) Chercheur n °: 20311409

(2) Aucun coordinateur de recherche

(3) Chercheur collaboratif Gaku Miura (Université de Kyushu, Recherche médicale) Département / Professeur) Numéro du chercheur: 10324617

 

 

 

  • Like 4
  • Thanks 1

Share this post


Link to post
Share on other sites

et je précise qu'on ne l'a pas fait pour les cookies :p wuf est parfaitement innocent je n'ai vu la proposition qu'après ^^ 

Share this post


Link to post
Share on other sites

Je ne dirais qu'un chose : wouahou !

Share this post


Link to post
Share on other sites

C'est hyper intéressant. Je crois que c'est la première fois que je vois parler de Zeb2 dans le contexte downunder. Visiblement, on retrouve la crête neurale dans l'histoire :

https://ghr.nlm.nih.gov/gene/ZEB2

 

Edit. Et visiblement, Zeb2 est associé chez l'homme à une maladie (syndrome de Mowat-Wilson) très souvent associé à la maladie de Hirschprung (= mégacolon). Ce qui établirait un lien crédible entre downunder et risque de MC. https://fr.wikipedia.org/wiki/Syndrome_de_Mowat-Wilson

 

Il va falloir nettoyer un peu la traduc mais c'est vraiment une super base !!! Merci Wuf :love:

  • Thanks 1

Share this post


Link to post
Share on other sites

@Aggie @Cocow au cas où vous ne passeriez pas dans le coin, ça peut vous intéresser !

  • Like 1

Share this post


Link to post
Share on other sites
Sign in to follow this  

×
×
  • Create New...

Important Information

En poursuivant votre navigation sur ce site, vous acceptez l’utilisation de cookies permettant d'améliorer votre expérience de navigation et mémoriser vos paramètres utilisateur pendant votre visite. Aucune information contenue dans ces cookies ne permet de vous identifier sans votre permission. SRFA ne transmet aucune information non anonyme à des applications tierces.